View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15167_high_13 (Length: 391)
Name: NF15167_high_13
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15167_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 105 - 359
Target Start/End: Complemental strand, 50562084 - 50561830
Alignment:
| Q |
105 |
gaacacccctaattcgaacaacgttacttggagaaagaaccatgagaagaacttgactgaaccattattggtggaaggtgtgtcttcgtagtgagagttt |
204 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50562084 |
gaacacccctaattcgaacgacgttacttggagaaagaaccatgagaagaacttggttgaaccattattagtggaaggtgtgtcttcgtagtgagagttt |
50561985 |
T |
|
| Q |
205 |
agagattaacaagatcgttggagcttgaaggatgcagaagtgtttgtgttggtgaattacgagtttctttct-aagtataaaaaatgagtgttgtactta |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
50561984 |
agagattaacaagatcgttggagcttgaaggatgcataagggtttgtgttggtgaattacgagtttctttctcgagtataaaaaatgagtgttgtactta |
50561885 |
T |
|
| Q |
304 |
aagtaatttttcacggtaatgatatttagaccccccaaattaaatgattcaatatc |
359 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50561884 |
aagtaattttttacggtaatgatatttaga-cccccaaattaaatgattcaatatc |
50561830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University