View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15167_high_14 (Length: 370)
Name: NF15167_high_14
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15167_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 29 - 362
Target Start/End: Original strand, 48857595 - 48857915
Alignment:
| Q |
29 |
tatatctagcatagtttagccaaatgcattgtttaaacatatatattaacataaacttatagggcgggttatatatttttcttggattgtctcatcttcc |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48857595 |
tatatctagcatagtttagccaaatgcattgtttaaacatatatattaacataaatttatagggcgggttatatatttttcttggattgtctcatcttcc |
48857694 |
T |
|
| Q |
129 |
tagctaaataaaatgatgaccttcttcatttaaattgagcacaacgtaatatgtttcgtgcagcaatgcattgatgttacgcatcaactatatacg--gg |
226 |
Q |
| |
|
|| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
48857695 |
ta----aataaaatgatgacctc--------aaattgagcacaacgtaatatgtttcgtgcagcaatgcattgatgttacgcatgaactatatacgttgg |
48857782 |
T |
|
| Q |
227 |
aatacatatttattaccgtcgcttnnnnnnnnnnnnnnnnnacggagttgttcaagttaaacctcgtcatttcaaattaaaccnnnnnnnnnnnnnnnng |
326 |
Q |
| |
|
|||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
48857783 |
aatacatatttattactgtcgcttaaaaagaatatttttttatggagttgttcaagttaaacctcgtcatttcaaattaaaccttttttttttttt---g |
48857879 |
T |
|
| Q |
327 |
gcgaaatcgttcaagttaaatctcgtaatattcttc |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48857880 |
gcgaaatcgttcaagttaaatctcgtaatattcttc |
48857915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University