View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15167_high_18 (Length: 337)
Name: NF15167_high_18
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15167_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 185 - 318
Target Start/End: Complemental strand, 35159663 - 35159530
Alignment:
| Q |
185 |
aagcacctgagaaaccatgtctcaaatgcatcaaccatcaaactcaataaaccatcacagtaacatatattgttttgggatgtagtacatgcttcgagtt |
284 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35159663 |
aagcacgtgagaaaccatgtctcaaatgcatcaaccatcaaactcaataaaccatcaaaataacatatattgttttgggatgtagtacatgcttcgagtt |
35159564 |
T |
 |
| Q |
285 |
tttctcaacttgataatactcctacggtcatatt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35159563 |
tttctcaacttgataatactcctacggtcatatt |
35159530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 35159850 - 35159737
Alignment:
| Q |
1 |
atgttccgtcataagacacatcaccaccaccggacaaagttgatatgagatttggtgg---tggttcttctcataaaccactaccgctgaatttgatatt |
97 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
35159850 |
atgttccgccataagacacatcaccaccacgggacaaagttgatatgagatttggtggtggtggttcttctgataaaccactgccgctgaatttgatatt |
35159751 |
T |
 |
| Q |
98 |
gattgcataagtaa |
111 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35159750 |
gattgcataagtaa |
35159737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University