View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15167_high_21 (Length: 328)
Name: NF15167_high_21
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15167_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 14 - 318
Target Start/End: Complemental strand, 9956361 - 9956054
Alignment:
| Q |
14 |
ttattctagtaatagattttaaatcagannnnnnnaggtgcactttaacttcttctagtttgagagaggttggttttggttgtagtcttcaaacaagatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
9956361 |
ttattctagtaatagattttaaatcagattattttaggtgcactttaacttcttctagtttgagagaggatgattttggttgtaatcttcaaacaagatt |
9956262 |
T |
|
| Q |
114 |
ttttacaagaaagtttcattaatttcttc---attgtagtacgacaaagtaactctcattggatgaatgtgtggaaatggtcggagggtcctcaaaagaa |
210 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9956261 |
ttttacaataaagtttcattaatttcttcttcattgtagtacgacaaagtaactctcattggatgaatgtgtggaaatggtcggagggtcctcaaaagaa |
9956162 |
T |
|
| Q |
211 |
taaatgttttctttgacttgtttatagtaatgggtttgagactaatgataaaggaaatagatgtggtattgattaaactttctctttttatctctaattt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9956161 |
taaatgttttctttgacttgtttatagtaatgggtttgagactaatgataaaggaaatagatgtggtattgattaaactttctctttttatctctaattg |
9956062 |
T |
|
| Q |
311 |
gatgatgt |
318 |
Q |
| |
|
||| |||| |
|
|
| T |
9956061 |
gatcatgt |
9956054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University