View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15167_high_24 (Length: 298)
Name: NF15167_high_24
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15167_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 161 - 283
Target Start/End: Original strand, 40865568 - 40865691
Alignment:
| Q |
161 |
tataaatatatat-tattattctgcaccttgatttgtagcttggtattgttataagttgcactttgtttttcccgttgtcacaattcatgcattgccatg |
259 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40865568 |
tatatatatatatatattattctgcaccttgatttgtagcttggtattgttataagttgcactttgttttttccgttgtcacaattcatgcattgccatg |
40865667 |
T |
 |
| Q |
260 |
tctttgtcgtctcttccctctgtg |
283 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
40865668 |
tctttgtcgtctcttccctttgtg |
40865691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 23 - 131
Target Start/End: Original strand, 40865400 - 40865508
Alignment:
| Q |
23 |
tctaggagaagatccgccgctgagcccaggctcgccggacggtaaatctgcccatgcttaataggttctagccacttatcagtgtctcttattttttgta |
122 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||| |
|
|
| T |
40865400 |
tctaggagaaaatccgccgctgagcccaggctcgccaggcggtaaatctgcccatgcttaataggttctagccacttgtctgcgtctcttattttttgta |
40865499 |
T |
 |
| Q |
123 |
tggttgcct |
131 |
Q |
| |
|
||||||||| |
|
|
| T |
40865500 |
tggttgcct |
40865508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University