View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15167_high_30 (Length: 267)
Name: NF15167_high_30
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15167_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 19 - 247
Target Start/End: Complemental strand, 2670597 - 2670365
Alignment:
| Q |
19 |
cttaaagcgagtagtgtgggttttaaaggagtttgactttggtccatttaagatacctctatttatacttgttcacta-----ccatatgtatgacatgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2670597 |
cttaaagcgagtagtgtgggttttaaaggagtttgactttggtccatttaagatacctctatttatacttgttcactacgtacccatatgtatgacatgt |
2670498 |
T |
 |
| Q |
114 |
ggcaaaaacaattgagataaaagattagaaatagccannnnnnnactggnnnnnnnnnntcccacacactctctcaaacaacaccatgttgcttcttctt |
213 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2670497 |
gacaaaaacaattgagataaaagattagaaatagccatttttttact-gcaaaaaaaaatcccacacactctctcaaacaacaccatgttgcttcttctt |
2670399 |
T |
 |
| Q |
214 |
cctttgaaacaacatggtcgctgcctctccctct |
247 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| |
|
|
| T |
2670398 |
cctttgaaacaacatggtcgttgactctccctct |
2670365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University