View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15167_high_35 (Length: 239)
Name: NF15167_high_35
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15167_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 52111927 - 52111706
Alignment:
| Q |
1 |
tattggcccagattaagataatttaagtttttgtttgtttgtttatgatgactacttgtacgtattacgagaggaatgtgaccaacttcacctatgaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52111927 |
tattggcccagattaagataatttaagtttttgtttgtttgtttatgatgactacttgtacgtattacgagaggaatgtgaccaacttcacctatgaagt |
52111828 |
T |
 |
| Q |
101 |
taannnnnnnagaatttatttaattaatttaatcaccaccaatatgtttgattaggatgattaatgcttctattacgttacgtgcacaatggaaggcgat |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52111827 |
taatttttttagaatttatttaattaatttaatcaccaccaatatgtttgattaggatgattaatgcttctattacgttacgtgcacaatggaaggcgat |
52111728 |
T |
 |
| Q |
201 |
aaaaactaatttagctagatgt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52111727 |
aaaaactaatttagctagatgt |
52111706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University