View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15167_high_7 (Length: 496)
Name: NF15167_high_7
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15167_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 10 - 463
Target Start/End: Complemental strand, 32288510 - 32288054
Alignment:
| Q |
10 |
agcagcacagacagactaactaagcaccattgccagcaccaagnnnnnnnnnn---ctaagcactaaaaatactatagctagctatgacccatgacctta |
106 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32288510 |
agcaacacacacagactaactaagcaccattgccagcaccaagaaaagaaaaaaaactaagcactaataatactatagctagctatgacccatgacctta |
32288411 |
T |
|
| Q |
107 |
tatatcaatgcacgcagcttcttcatttctgcttattgccacccatgttcatgttcattccagcattgccacctgcagcaccaccgccgccgccgcccat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32288410 |
tatatcaatgcacgcagcttcttcatttctgcttattgccacccatgttcatgttcattccagtattgccacctgcagcaccaccgccgccgccacccat |
32288311 |
T |
|
| Q |
207 |
atttgcttcttgtccaccctgtcctccaccagcatttgcatcgccaaatccaggagcagcagtgccatatacagcagtgtattcataccttgaggtggtg |
306 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32288310 |
atttgcttcttgtccactctgtcctccaccagcatttgcatcgccaaatccaggagcagcagtgccatatacagcagtgtattcataccttgaggtggtg |
32288211 |
T |
|
| Q |
307 |
gtgccatcaggtgttactccggtggcctcataagcgtatgcggtcaccgggtatgcggctactggttccgtaacaccactttggaatgcatcgctcttct |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32288210 |
gtgccatcaggtgttactccggtggcctcataagcgtatgcggtcaccgggtatgcggctactggttccgtaacaccactttggaatgcatcgctcttcc |
32288111 |
T |
|
| Q |
407 |
gaatatctttttcactatcgcccgttctaggaagattttgaaattgatcgttagggc |
463 |
Q |
| |
|
|||||||||||||||||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
32288110 |
gaatatctttttcactatcgtccgttcttgaaagattttgaaattgatcgttagggc |
32288054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University