View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15167_low_18 (Length: 351)
Name: NF15167_low_18
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15167_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 16 - 158
Target Start/End: Complemental strand, 32556484 - 32556342
Alignment:
| Q |
16 |
atagggcgcgcgagaaatcattatcatgggaatagaaggaatctataatatatgtatgaaacggtattgtcacacctaagtatagacttttaaaacattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32556484 |
atagggcgcgcgagaaatcattatcatgggaatagaaggaatctataatatatgtatgaaacggtattgtcacacctaagtatagacttttaaaacattt |
32556385 |
T |
 |
| Q |
116 |
ctagggatacttttatctttttcttaaacaaatcggattcatg |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32556384 |
ctagggatacttttatctttttcttaaacaaatcggattcatg |
32556342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 222 - 336
Target Start/End: Complemental strand, 32556278 - 32556164
Alignment:
| Q |
222 |
gatgggcttatgcccttgaatgtaacaaaacaagaaaaatatagtagtttctaactaatataaaagaaactactcaattgagctccactagtgcaacctt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32556278 |
gatgggcttatgcccttgaatgtaacaaaacaagaaaaatatagtagtttctaactaatataaaagaaactactcaattgagctccactagtgcaacctt |
32556179 |
T |
 |
| Q |
322 |
tttatgggttgatac |
336 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32556178 |
tttatgggttgatac |
32556164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University