View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15167_low_22 (Length: 329)
Name: NF15167_low_22
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15167_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 977115 - 976944
Alignment:
| Q |
18 |
agtattcatgttaatattgttttccttccctctacctcccagggatctgctgccgacataattaaaattgcaatgattaaaatttactctgaaattttta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
977115 |
agtattcatgttaatattgttttccttccctctacctcccagggatctgctgccgacataattaaaattgcaatgattaaaatttactctgaaatttttc |
977016 |
T |
 |
| Q |
118 |
ctggagttgataacctggattcgagttcttcagtcacagccaagttcgacatgcttagagatcgttgccgga |
189 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
977015 |
ctggagttgataagctggattcgagttcttcagtcacagccaagttcgaaatgcttagagatcgttgccgga |
976944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 256 - 319
Target Start/End: Complemental strand, 976879 - 976816
Alignment:
| Q |
256 |
aatcatttcagtaaatgttaactaggtacacgatgaattagtgctggaagttgatccctctgtg |
319 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
976879 |
aatcatttcagtatatgttaactaggtacacgatgaattagtgctggaagttgatccctctgtg |
976816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University