View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15167_low_43 (Length: 211)
Name: NF15167_low_43
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15167_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 10)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 4 - 196
Target Start/End: Complemental strand, 27585693 - 27585498
Alignment:
| Q |
4 |
acactgcgagatatccctttggcacgtccacaacttttgaaactgatcggcttgaagtaaatgatgatgaccttctaatgataccaggtnnnnnnn---c |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
27585693 |
acactgcgagatatccctttggcacgtccacaacttttgaaactgatcggcttgaagtaaatgatgatgaccttctaatgataccaggtaaacgaaaaac |
27585594 |
T |
|
| Q |
101 |
ccttagggaggcagggaccgcgaagttctggtatgcaaatttcacggggtttgtcttgcaaaaatatataatatgtggttcattatgactcatgat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27585593 |
ccttagggaggcagggaccgcgaagttctggtatgcaaatttcacggggtttgtcttgcaaaaatatataatatgtggttcattatgactcatgat |
27585498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 27563478 - 27563569
Alignment:
| Q |
1 |
cgtacactgcgagatatccctttggcacgtccacaacttttgaaactgatcggcttgaagtaaatgatgatgaccttctaatgataccaggt |
92 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27563478 |
cgtacactgcaagatagccctttggcacgtccacaacttttgtaactgatcggcttgaagtaaacgatgatgaccttctaatgataccaggt |
27563569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 103 - 196
Target Start/End: Original strand, 27564006 - 27564097
Alignment:
| Q |
103 |
ttagggaggcagggaccgcgaagttctggtatgcaaatttcacggggtttgtcttgcaaaaatatataatatgtggttcattatgactcatgat |
196 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||||| |||||||||||||||||| |||||| ||||||||||| ||| |||||||| |
|
|
| T |
27564006 |
ttagggaggcagggcccgcgaagttctggtgtgcgaatttcatggggtttgtcttgcaaaa--atataaaatgtggttcataatggctcatgat |
27564097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 3 - 53
Target Start/End: Original strand, 27566085 - 27566135
Alignment:
| Q |
3 |
tacactgcgagatatccctttggcacgtccacaacttttgaaactgatcgg |
53 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27566085 |
tacactgcaagatatccctttggcacgtccacaacttttgaaactgctcgg |
27566135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 3 - 70
Target Start/End: Complemental strand, 27415630 - 27415563
Alignment:
| Q |
3 |
tacactgcgagatatccctttggcacgtccacaacttttgaaactgatcggcttgaagtaaatgatga |
70 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||| | |||||||| || ||||||||| |
|
|
| T |
27415630 |
tacactgcaagatatccctttggcacatccacaacttttgaaattactcggcttgcagaaaatgatga |
27415563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 27420411 - 27420348
Alignment:
| Q |
6 |
actgcgagatatccctttggcacgtccacaacttttgaaactgatcggcttgaagtaaatgatg |
69 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||| |||||||| ||| || |||||||| |
|
|
| T |
27420411 |
actgcaagatatccctttggcacgtccacagattttgaagctgatcggtttgcagaaaatgatg |
27420348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 27425815 - 27425752
Alignment:
| Q |
6 |
actgcgagatatccctttggcacgtccacaacttttgaaactgatcggcttgaagtaaatgatg |
69 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||| ||| |||||||| ||| || |||||||| |
|
|
| T |
27425815 |
actgcaagatatccctttggcacgtccacagctttcgaagctgatcggtttgcagaaaatgatg |
27425752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 27469468 - 27469425
Alignment:
| Q |
1 |
cgtacactgcgagatatccctttggcacgtccacaacttttgaa |
44 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||| |||||||| |
|
|
| T |
27469468 |
cgtacactgctagatatccctttggaacgtccacagcttttgaa |
27469425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 27486991 - 27486948
Alignment:
| Q |
1 |
cgtacactgcgagatatccctttggcacgtccacaacttttgaa |
44 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||| |||||||| |
|
|
| T |
27486991 |
cgtacactgctagatatccctttggaacgtccacagcttttgaa |
27486948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 53
Target Start/End: Original strand, 27570186 - 27570233
Alignment:
| Q |
6 |
actgcgagatatccctttggcacgtccacaacttttgaaactgatcgg |
53 |
Q |
| |
|
||||| ||||||||||||||||| |||||| |||||||| |||||||| |
|
|
| T |
27570186 |
actgcaagatatccctttggcacatccacagcttttgaagctgatcgg |
27570233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University