View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15167_low_43 (Length: 211)

Name: NF15167_low_43
Description: NF15167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15167_low_43
NF15167_low_43
[»] chr4 (10 HSPs)
chr4 (4-196)||(27585498-27585693)
chr4 (1-92)||(27563478-27563569)
chr4 (103-196)||(27564006-27564097)
chr4 (3-53)||(27566085-27566135)
chr4 (3-70)||(27415563-27415630)
chr4 (6-69)||(27420348-27420411)
chr4 (6-69)||(27425752-27425815)
chr4 (1-44)||(27469425-27469468)
chr4 (1-44)||(27486948-27486991)
chr4 (6-53)||(27570186-27570233)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 10)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 4 - 196
Target Start/End: Complemental strand, 27585693 - 27585498
Alignment:
4 acactgcgagatatccctttggcacgtccacaacttttgaaactgatcggcttgaagtaaatgatgatgaccttctaatgataccaggtnnnnnnn---c 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |    
27585693 acactgcgagatatccctttggcacgtccacaacttttgaaactgatcggcttgaagtaaatgatgatgaccttctaatgataccaggtaaacgaaaaac 27585594  T
101 ccttagggaggcagggaccgcgaagttctggtatgcaaatttcacggggtttgtcttgcaaaaatatataatatgtggttcattatgactcatgat 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27585593 ccttagggaggcagggaccgcgaagttctggtatgcaaatttcacggggtttgtcttgcaaaaatatataatatgtggttcattatgactcatgat 27585498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 27563478 - 27563569
Alignment:
1 cgtacactgcgagatatccctttggcacgtccacaacttttgaaactgatcggcttgaagtaaatgatgatgaccttctaatgataccaggt 92  Q
    |||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||    
27563478 cgtacactgcaagatagccctttggcacgtccacaacttttgtaactgatcggcttgaagtaaacgatgatgaccttctaatgataccaggt 27563569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 103 - 196
Target Start/End: Original strand, 27564006 - 27564097
Alignment:
103 ttagggaggcagggaccgcgaagttctggtatgcaaatttcacggggtttgtcttgcaaaaatatataatatgtggttcattatgactcatgat 196  Q
    |||||||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||  |||||| ||||||||||| ||| ||||||||    
27564006 ttagggaggcagggcccgcgaagttctggtgtgcgaatttcatggggtttgtcttgcaaaa--atataaaatgtggttcataatggctcatgat 27564097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 3 - 53
Target Start/End: Original strand, 27566085 - 27566135
Alignment:
3 tacactgcgagatatccctttggcacgtccacaacttttgaaactgatcgg 53  Q
    |||||||| ||||||||||||||||||||||||||||||||||||| ||||    
27566085 tacactgcaagatatccctttggcacgtccacaacttttgaaactgctcgg 27566135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 3 - 70
Target Start/End: Complemental strand, 27415630 - 27415563
Alignment:
3 tacactgcgagatatccctttggcacgtccacaacttttgaaactgatcggcttgaagtaaatgatga 70  Q
    |||||||| ||||||||||||||||| |||||||||||||||| |  |||||||| || |||||||||    
27415630 tacactgcaagatatccctttggcacatccacaacttttgaaattactcggcttgcagaaaatgatga 27415563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 27420411 - 27420348
Alignment:
6 actgcgagatatccctttggcacgtccacaacttttgaaactgatcggcttgaagtaaatgatg 69  Q
    ||||| ||||||||||||||||||||||||  ||||||| |||||||| ||| || ||||||||    
27420411 actgcaagatatccctttggcacgtccacagattttgaagctgatcggtttgcagaaaatgatg 27420348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 27425815 - 27425752
Alignment:
6 actgcgagatatccctttggcacgtccacaacttttgaaactgatcggcttgaagtaaatgatg 69  Q
    ||||| |||||||||||||||||||||||| |||| ||| |||||||| ||| || ||||||||    
27425815 actgcaagatatccctttggcacgtccacagctttcgaagctgatcggtttgcagaaaatgatg 27425752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 27469468 - 27469425
Alignment:
1 cgtacactgcgagatatccctttggcacgtccacaacttttgaa 44  Q
    |||||||||| |||||||||||||| ||||||||| ||||||||    
27469468 cgtacactgctagatatccctttggaacgtccacagcttttgaa 27469425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 27486991 - 27486948
Alignment:
1 cgtacactgcgagatatccctttggcacgtccacaacttttgaa 44  Q
    |||||||||| |||||||||||||| ||||||||| ||||||||    
27486991 cgtacactgctagatatccctttggaacgtccacagcttttgaa 27486948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 53
Target Start/End: Original strand, 27570186 - 27570233
Alignment:
6 actgcgagatatccctttggcacgtccacaacttttgaaactgatcgg 53  Q
    ||||| ||||||||||||||||| |||||| |||||||| ||||||||    
27570186 actgcaagatatccctttggcacatccacagcttttgaagctgatcgg 27570233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University