View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15169_high_16 (Length: 227)
Name: NF15169_high_16
Description: NF15169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15169_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 40598749 - 40598543
Alignment:
| Q |
15 |
agatagatttattaattactataatttcacagtccatatcaggtaatcatcttctaccaatcaatcacattgaaatttagtttaagttgagtacgaataa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40598749 |
agatagatttattaattactataatttcacagtcaatatcaggtaatcatcttctaccaatcaatcacatggaaatttagtttaagttgagtacgaataa |
40598650 |
T |
 |
| Q |
115 |
ttaaaaccacttccgccatcgccatcttcaacattgataacggacggtgttgcattgatcatgttttcattctcttcagtaactaatattccctctagtc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40598649 |
ttaaaaccacttccgccatcgccatcttcaacattgataacggacggtgttgcattgatcatgttttcattctcttcagtaactaatattccctctagtc |
40598550 |
T |
 |
| Q |
215 |
cctttgc |
221 |
Q |
| |
|
|| |||| |
|
|
| T |
40598549 |
ccattgc |
40598543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University