View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15169_low_10 (Length: 265)
Name: NF15169_low_10
Description: NF15169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15169_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 258
Target Start/End: Complemental strand, 35616792 - 35616550
Alignment:
| Q |
16 |
agtctcccctatcaattactttaccggtgcttcaagtgcatttgcagtgcaataaaataatatctttatattattggatgtttttaataaaatacaaaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35616792 |
agtctcccctatcaattactttaccggtgcttcaagtgcatttgcagtgcaataaaataatatctttatattattggatgtttttaataaaatacaaaag |
35616693 |
T |
 |
| Q |
116 |
gaaacatcacagttcaatatttagagtgttgcatacaatgattcgaggactaggatacataaaaatttactcatttatccatccaaatcatgcatcgaag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35616692 |
gaaacatcacagttcaatatttagagtgttgcatacaatgattcgaggactaggatacataaaaatttactcaattatccatccaaatcatgcatcgaag |
35616593 |
T |
 |
| Q |
216 |
acatattccgtttctcaataaatcaaaagctttgatgatgtcc |
258 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35616592 |
acattgtccgtttctcaataaatcaaaagctttgttgatgtcc |
35616550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University