View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15169_low_10 (Length: 265)

Name: NF15169_low_10
Description: NF15169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15169_low_10
NF15169_low_10
[»] chr3 (1 HSPs)
chr3 (16-258)||(35616550-35616792)


Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 258
Target Start/End: Complemental strand, 35616792 - 35616550
Alignment:
16 agtctcccctatcaattactttaccggtgcttcaagtgcatttgcagtgcaataaaataatatctttatattattggatgtttttaataaaatacaaaag 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35616792 agtctcccctatcaattactttaccggtgcttcaagtgcatttgcagtgcaataaaataatatctttatattattggatgtttttaataaaatacaaaag 35616693  T
116 gaaacatcacagttcaatatttagagtgttgcatacaatgattcgaggactaggatacataaaaatttactcatttatccatccaaatcatgcatcgaag 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
35616692 gaaacatcacagttcaatatttagagtgttgcatacaatgattcgaggactaggatacataaaaatttactcaattatccatccaaatcatgcatcgaag 35616593  T
216 acatattccgtttctcaataaatcaaaagctttgatgatgtcc 258  Q
    ||||  |||||||||||||||||||||||||||| ||||||||    
35616592 acattgtccgtttctcaataaatcaaaagctttgttgatgtcc 35616550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University