View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15169_low_16 (Length: 235)
Name: NF15169_low_16
Description: NF15169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15169_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 24855876 - 24856095
Alignment:
| Q |
1 |
ttcacaaagtaaagcttagttagacactcaattagaaagnnnnnnnnnctccttataccatgttcaaaatcaatttattgtaattgttttattttcccaa |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24855876 |
ttcacaaagtaaagcttagtgagacactcaattagatagtttttttttctccttataccatgttcaaaatcaattcattgtaattgttttattttcccaa |
24855975 |
T |
 |
| Q |
101 |
ttcatcatgttagctctatggaacaattgaagcatggtctcaaatgtcagcatatgaagaagataggcaacactggattgtgtttgacagtgtctcaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24855976 |
ttcatcatgttagctctatggaacaattgaagcatggtctcaaatgtcagcatatgaagaagataggcaacactggattgtgtttgatagtgtctcaaat |
24856075 |
T |
 |
| Q |
201 |
ttcaaagttgatggtggtgg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
24856076 |
ttcaaagttgatggtggtgg |
24856095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University