View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15169_low_19 (Length: 218)
Name: NF15169_low_19
Description: NF15169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15169_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 19 - 193
Target Start/End: Original strand, 2255872 - 2256046
Alignment:
| Q |
19 |
aattaagtctaactcatatttataaaacctaaaccattcgtaaactcatacttataaaaccatttgtaaggcgaagaatgtttaatctaannnnnnnnca |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| | | |||||| || |
|
|
| T |
2255872 |
aattgagtctaactcatatttataaaacctaaaccattcgtaaactcatacttataaaaccatttgtaaagcaaagaatatctgatctaattttttttca |
2255971 |
T |
 |
| Q |
119 |
atacatcatctcacgaccaacacgactaacttaatgggtgtatataaatgatgaatgacctgatcattatgctct |
193 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
2255972 |
atacatcatcttacgaccaacacgactaacttgatgcgtgcatataaatgataaatgacctgatcattatgctct |
2256046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University