View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15169_low_7 (Length: 370)
Name: NF15169_low_7
Description: NF15169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15169_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 123 - 352
Target Start/End: Complemental strand, 27917066 - 27916833
Alignment:
| Q |
123 |
ttacacatacgacatcaagttatataacttttttgggtacaacaagttatatttgattcgacttatataga--aagttatttcagcttcacgtataagaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
27917066 |
ttacacatacgacatcaagttatataacttttttgggtacaacaagttatatttgattcgacttatatatataaagttatttcagcttcacgtataagaa |
27916967 |
T |
 |
| Q |
221 |
gtgattgcttctacctaatgcaaaaagacaatttcaacttggtcaattaccattacaaaataagatacttgtgattttggaaaaac--aaccaaattcca |
318 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
27916966 |
gttattgcttctacctaatgcaaaaagacaatttcaacttggtcaattaccattacaaaataagatagttgtgattttggaaaaacaaaaccaaattcca |
27916867 |
T |
 |
| Q |
319 |
cttacgagaagttagaatcactccttgccccatc |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27916866 |
cttacgagaagttagaatcactccttgccccatc |
27916833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 50 - 125
Target Start/End: Complemental strand, 27917202 - 27917128
Alignment:
| Q |
50 |
cacaattgctaaaccccatgccaaagacatcaatattacacaagttatggaatgttctttaaattatagatgttta |
125 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27917202 |
cacaattgctaaaccccatgccaa-gacatcaatattacacaagttatggaatgttctttaaattatagatattta |
27917128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University