View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15169_low_8 (Length: 336)
Name: NF15169_low_8
Description: NF15169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15169_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 33643433 - 33643107
Alignment:
| Q |
1 |
ctaacttctaactgtatcatttttt-gtttcaaacctaccaatttgccagcttgttaaatttttctgtcctttagtagtctccgtaggaactatggatct |
99 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33643433 |
ctaacttctaactgtatcatttttttgtttcaaacctaccaatttgccagattgttaaatttttctgtcctttagtagtctccgtaggaactatggatct |
33643334 |
T |
|
| Q |
100 |
gtgtgataatcttggttaattttatgaaacttaaatcttattatatgattttaaattgctattcattcagatattgccacatcaaatgttttagta---a |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33643333 |
gtgtgataatcttggttaattttatgaaacttaaatcttattatatgattttaaattgctattcattcagatattgccacatcaaatgttttagtatata |
33643234 |
T |
|
| Q |
197 |
tacagaagcacgttttctcaatatttctctagtattattgttctggcagaagcttgcaaaattgcaaatgaagtttaatgtgtttgctagaaaataatca |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33643233 |
tacagaagcacgttttctcaatatttctctagtattattgttctggcagaagcttgcaaaattgcaaatgaagtttaatgtgtttgctagaaaataatca |
33643134 |
T |
|
| Q |
297 |
aactatacatgaggaccataacaacac |
323 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
33643133 |
aactatacatgaggaccataacaacac |
33643107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University