View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15169_low_9 (Length: 291)
Name: NF15169_low_9
Description: NF15169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15169_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 19 - 279
Target Start/End: Complemental strand, 11624525 - 11624265
Alignment:
| Q |
19 |
ttaacgacactcgaaataatggtgatcgtttttcgagtgcgtcttctgttacagtttcaaaatccatggaggaaagtggtaaaaacatgacacaagaatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11624525 |
ttaacgacactcgaaataatggtgatcgtttttcaagtgcgtcttctgttacagtttcaaaatccatggaggaaagtggtaaaaacatgacacaagaatc |
11624426 |
T |
 |
| Q |
119 |
attgccacagcaaaataatggtttcattcctcaagttccatgtatgactagtgttccttggccttatacttggagttctggtgcaattccctcgccgcaa |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11624425 |
attgccacagaaaaataatggtttcattccccaagttccatgtatgactagtgttccttggccttatacttggagttctggcgcaattccctcgccgcaa |
11624326 |
T |
 |
| Q |
219 |
actttgtgtcctccgggatttcccatgtcattttaccctgctcctttttggaatgttcctt |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11624325 |
actttgtgtcctccgggatttcccatgtcattttaccctgctcctttttggaatgttcctt |
11624265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University