View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1516_high_37 (Length: 250)
Name: NF1516_high_37
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1516_high_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 3918229 - 3917991
Alignment:
| Q |
1 |
agtcatgctcctttatcaagtggaaaagacaaagtttattatggaaggacttgtcccgattccaccaccagggttagatacattacgtatc--aatgttt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
3918229 |
agtcatgctcctttatcaagtggaaaagacaaagtttattttggaaggacttgtcccgattccaccaccaaggttagatacattacgtatcccaatgttt |
3918130 |
T |
|
| Q |
99 |
ctagttgcttgtttcatttgcattaattaactcaaaatggaaaaaacggtttatatataatatcatactacagatggaacttgtatactatagttgctct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3918129 |
ctagttgcttgtttcatttgcattaattaactcaaaatggaaaaaacggtttatatataatatcatactacagatggaacttgtatactatagttgctct |
3918030 |
T |
|
| Q |
199 |
tctgatatttgtcctatccaacattctcaccttaatcct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3918029 |
tctgatatttgtcctatccaacattctcaccttaatcct |
3917991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University