View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1516_high_39 (Length: 248)
Name: NF1516_high_39
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1516_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 42551411 - 42551179
Alignment:
| Q |
1 |
gttgcttatatctaaacttctgcaccatacaa-cttttctccatagttcatcaattttcttatgagtgtattctcttgaaatattcatatagcaaagcta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42551411 |
gttgcttatatctaaacttctgcaccatacactcttttctccatagttcatcaattttcttatgagtgtattctcttgaaatattcatatagcaaatcta |
42551312 |
T |
 |
| Q |
100 |
cttt----gttctatacatggcttcaaatatttgcaaaccttcacgtcgtgataattctctaataataaaaccaaccaaatatacctcaaagcctaccct |
195 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42551311 |
ctttaattgttctatacatggcttcaaatatttgcaaaccttcacgtcgtgataattctctaataataaaaccaaccaaatatacctcaaagcctaccct |
42551212 |
T |
 |
| Q |
196 |
tttgctcaaagactacctccgagatgacctaag |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42551211 |
tttgctcaaagactacctccgagatgacctaag |
42551179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University