View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1516_high_42 (Length: 246)
Name: NF1516_high_42
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1516_high_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 151 - 231
Target Start/End: Complemental strand, 35629042 - 35628961
Alignment:
| Q |
151 |
gtactgtactatctcttccttcatagtttgacttacagatgttaaatcaatattgtgc-atatgatgtcaattaatatgaat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35629042 |
gtactgtactatctcttccttcatagtttgacttacatatgttaaatcaatattgtgcaatatgatgtcaattaatatgaat |
35628961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 35629197 - 35629109
Alignment:
| Q |
1 |
tggaagtgacaatgtattgtccttctatagttcttttgttttcttcttaatttcaaata-----atccgtatctgtttacgtgatagtg |
84 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
35629197 |
tggaagtgacaatgtattgtccttctataattcttttgttttcttcttaatttcaaataatccaatccgtatcagtttacgtgatagtg |
35629109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University