View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1516_high_54 (Length: 229)
Name: NF1516_high_54
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1516_high_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 48097622 - 48097419
Alignment:
| Q |
19 |
agcatgatcaaatgtaacatggagacaacctctttcaacaataattctatatatggggtacaacatgtgctttagagaatcttcagggtgcacattcttg |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
48097622 |
agcacgatcaaatgtaacatggagacaacctctttcaacaataattctatatatgaggtacaacatgtgctttagagaatcttcgggatgcacattcttg |
48097523 |
T |
 |
| Q |
119 |
gcaaat-ataatatttctacttctttgtcactcttctagaagctgaaaccatagactt---gggagctatcaaagtggtcatatcaaactaaatgaatgt |
214 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |||||||||| || || |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48097522 |
gcaaatcataatatttctacttctttgtcactcttctagaagctaaaaccatagatttgcgggaagctatcaaagtggtcatatcaaactgaatgaatgt |
48097423 |
T |
 |
| Q |
215 |
tgtt |
218 |
Q |
| |
|
|||| |
|
|
| T |
48097422 |
tgtt |
48097419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University