View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1516_high_56 (Length: 210)
Name: NF1516_high_56
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1516_high_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 12 - 143
Target Start/End: Complemental strand, 35948679 - 35948548
Alignment:
| Q |
12 |
aagaaattagagggggaaaggatgtttttgtcattgtgctattcctttattttctcgctagccctttattttctcaagtctatagtagatagatgtatcc |
111 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35948679 |
aagaaattagagggggaaatgatgtttttgtcattgtgctattcctttattttctcgctagccctttattttctcaagtctatagtagatagatgtatct |
35948580 |
T |
|
| Q |
112 |
atacatgtcgaattaacactgtagtaattctt |
143 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |
|
|
| T |
35948579 |
atacatgtcgaattaacactgtaataattctt |
35948548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University