View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1516_low_19 (Length: 384)
Name: NF1516_low_19
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1516_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 1 - 368
Target Start/End: Complemental strand, 47127400 - 47127035
Alignment:
| Q |
1 |
ataaaaattgggtattcagtgaacaagcactaccggctaatctgctcaagaggtaagttcaaaatccgaaacttctaacagtgcgaataggatttcctca |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47127400 |
ataaaaattgggtattcactgaacaagcactacctgctaatctgctcaagaggtaagttcaaaatccgaaacttctaacagtgcgaataggatttcctca |
47127301 |
T |
 |
| Q |
101 |
tgtagggggaaaccatgaaagnnnnnnnnnncgctcttattgatttagtccaatttatctaaacaaatggtaattatatttcatttgaaactttcagagg |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47127300 |
tgtagggggaaaccatgaaa--aaaaaaaaacgctcttattgatttagtccaatttatctaaacaaatggtaattatatttcatttgaaactttcagagg |
47127203 |
T |
 |
| Q |
201 |
catagcagttcctgattcaaatagccctcatggactaaaacttctgatagaagactacccttttgctgttgatggattggaaatatgggatgcaattgaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47127202 |
catagcagttcctgattcaaatagccctcatggactaaaacttctgatagaagactacccttttgctgttgatggattggaaatatgggatgcaattgaa |
47127103 |
T |
 |
| Q |
301 |
acctgggtgagtgaatattgtagtttctactacacatctgatgacatgattgagaatgactatgaact |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47127102 |
acctgggtgagtgaatattgtagtttctactacacatctgatgacatgattgagaatgactatgaact |
47127035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 245 - 293
Target Start/End: Original strand, 36745671 - 36745719
Alignment:
| Q |
245 |
tgatagaagactacccttttgctgttgatggattggaaatatgggatgc |
293 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
36745671 |
tgataaaagactacccttttgctgttgatggattagagatatgggatgc |
36745719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 240 - 293
Target Start/End: Complemental strand, 6449979 - 6449926
Alignment:
| Q |
240 |
acttctgatagaagactacccttttgctgttgatggattggaaatatgggatgc |
293 |
Q |
| |
|
|||| ||||||| |||||||||| ||||||||||||| | |||||||||||||| |
|
|
| T |
6449979 |
acttgtgatagaggactacccttatgctgttgatggactagaaatatgggatgc |
6449926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 248 - 293
Target Start/End: Complemental strand, 6456438 - 6456393
Alignment:
| Q |
248 |
tagaagactacccttttgctgttgatggattggaaatatgggatgc |
293 |
Q |
| |
|
||||||||||||||| ||||||||||||| | |||||||||||||| |
|
|
| T |
6456438 |
tagaagactacccttatgctgttgatggactagaaatatgggatgc |
6456393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 241 - 289
Target Start/End: Complemental strand, 6273740 - 6273692
Alignment:
| Q |
241 |
cttctgatagaagactacccttttgctgttgatggattggaaatatggg |
289 |
Q |
| |
|
||||||||||| |||||||||| ||||| ||||||||| || ||||||| |
|
|
| T |
6273740 |
cttctgatagaggactacccttatgctgctgatggattagagatatggg |
6273692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 241 - 293
Target Start/End: Complemental strand, 6320619 - 6320567
Alignment:
| Q |
241 |
cttctgatagaagactacccttttgctgttgatggattggaaatatgggatgc |
293 |
Q |
| |
|
||||||||||| |||||||||| ||||| ||||||| | || ||||||||||| |
|
|
| T |
6320619 |
cttctgatagaggactacccttatgctgctgatggactagagatatgggatgc |
6320567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 241 - 293
Target Start/End: Complemental strand, 6331081 - 6331029
Alignment:
| Q |
241 |
cttctgatagaagactacccttttgctgttgatggattggaaatatgggatgc |
293 |
Q |
| |
|
||||||||||| |||||||||| ||||| ||||||| | || ||||||||||| |
|
|
| T |
6331081 |
cttctgatagaggactacccttatgctgctgatggactagagatatgggatgc |
6331029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 241 - 288
Target Start/End: Original strand, 42689391 - 42689438
Alignment:
| Q |
241 |
cttctgatagaagactacccttttgctgttgatggattggaaatatgg |
288 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| || |||||| |
|
|
| T |
42689391 |
cttctgatagaggactacccttatgctgttgatggattagagatatgg |
42689438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University