View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1516_low_21 (Length: 370)
Name: NF1516_low_21
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1516_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 19 - 364
Target Start/End: Complemental strand, 28286977 - 28286633
Alignment:
| Q |
19 |
aggagacccgtctccgccaccttcatcctcattccccacctcagagagtctttaacccttgtccctgtctccgcggggacccatcaacactaaaaataag |
118 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
28286977 |
aggagacccgtctccgccaccttcatcttcattccccacctcagagagtttttaacccttgtccctgtctccgcggggacccatcagcactaaaagtaag |
28286878 |
T |
 |
| Q |
119 |
atcaaatttctattattttcaatgaactactcggggacagggtcctccggggcggggggttatgatatccatccccatttccaaatcaccattgaggga- |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28286877 |
aacaaatttctattattttcaatgaactactcggggacagggccctgcggggcg-ggggttatgatatccatccccatttccaaatcaccattgagggat |
28286779 |
T |
 |
| Q |
218 |
atttcccccttacttgtggggaaaatcttcccagccaaggagcccaaatgggacaatctccatgggatcccctcacttgcggatacaaattgatgttctt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
28286778 |
ttttcccccttacttgtggggaaaatcttcccacccaaggggcccaaatgggacaatctccatgggat-ccctcacttgcggatacaaattgatgctctt |
28286680 |
T |
 |
| Q |
318 |
actccaaaaccatggtatttctagttgttaacaatactttcttctca |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28286679 |
actccaaaaccatggtatttctagttgttaacaatactttcttctca |
28286633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University