View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1516_low_27 (Length: 350)
Name: NF1516_low_27
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1516_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 262
Target Start/End: Complemental strand, 43831102 - 43830858
Alignment:
| Q |
18 |
ctccgaaagtgagtgatgcagctgccataacattgaaaggctcatccacacctagcttccacgaaagcagattttgtataccaacatatgaagcaaagga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43831102 |
ctccgaaagtgagtgatgcagctgccataacattgaaaggctcatccacacctagcttccacgaaagcagattttgtatgccaacatatgaagcaaagga |
43831003 |
T |
|
| Q |
118 |
aattacatgtcctaataaatctttcttcattgtctcttgtagtactaatcctcagaaatcaaataacagtgttaaacttctcgtctaacataatcatttt |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43831002 |
aattaaatgtcctaataaatctttcttcattgtctcttgtagtactaatcctcagaaatcaaataacagtgttaaacttctcgtctaacataatcatttt |
43830903 |
T |
|
| Q |
218 |
gtatacaatgatagactgactaattttaagatcactcatctcatg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43830902 |
gtatacaatgatagactgactaattttaagatcactcatctcatg |
43830858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 321 - 350
Target Start/End: Complemental strand, 43830799 - 43830770
Alignment:
| Q |
321 |
agaagtataaatatatcaacttgatctatc |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43830799 |
agaagtataaatatatcaacttgatctatc |
43830770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University