View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1516_low_29 (Length: 334)
Name: NF1516_low_29
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1516_low_29 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 59; Significance: 6e-25; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 264 - 334
Target Start/End: Complemental strand, 42959657 - 42959588
Alignment:
| Q |
264 |
gatttaatgaaaaagcctacgtttcgcaatgaattaatgtttggatctcggttgatagaattattgatttt |
334 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42959657 |
gatttaatgaaaaagcctatgtttcg-aatgaattaatgtttggatctcggttgatagaattattgatttt |
42959588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 120 - 160
Target Start/End: Complemental strand, 42959804 - 42959764
Alignment:
| Q |
120 |
aggtggctgcgtggtggaacagcacgcatggcacgtgtgca |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42959804 |
aggtggctgcgtggtggaacagcacgcatggcacgtgtgca |
42959764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University