View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1516_low_38 (Length: 279)
Name: NF1516_low_38
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1516_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 2 - 122
Target Start/End: Original strand, 42960042 - 42960162
Alignment:
| Q |
2 |
accaaaaccaattttcatatnnnnnnnccctttttcttctatcatcttcatcatcctttgtgattgtgttatgggttttgcctcttttttaatggctttt |
101 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42960042 |
accaaaaccaattttcatataaaaaaaccctttttcttctatcatcttcatcatcctttgtgattgtgttatgggttttgcctcttttttaatggctttt |
42960141 |
T |
|
| Q |
102 |
cctcttcacaatcacaaaacc |
122 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42960142 |
cctcttcacaatcacaaaacc |
42960162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 185 - 264
Target Start/End: Original strand, 42960225 - 42960304
Alignment:
| Q |
185 |
aagttcacaccatgatttctctatcatggattctgaattcaactctttctacagcgactacacaccaccatcaccacctc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42960225 |
aagttcacaccatgatttctctatcatggattctgaattcaactctttctacagcgactacacaccaccatcaccacctc |
42960304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University