View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1516_low_4 (Length: 582)
Name: NF1516_low_4
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1516_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 8e-75; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 8e-75
Query Start/End: Original strand, 422 - 564
Target Start/End: Complemental strand, 56312079 - 56311937
Alignment:
| Q |
422 |
ccaggaagttcccaagggtcatagcgataaagatcgagaaaagtaataagctcaacgttgaaacgttttccctcgaccttacggcgaaggtagaactcta |
521 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312079 |
ccaggaagttcccaagggtcatagcgataaagatcgagaaaagtaataagctcaacgttgaaacgttttccctcgaccttacggcgaaggtagaactcta |
56311980 |
T |
|
| Q |
522 |
caagttcttcttcagttggatggaaacgaaaccctggcataac |
564 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311979 |
caagttcttcttcagttggatggaaacgaaaccctggcataac |
56311937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 122; E-Value: 3e-62
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 56312450 - 56312280
Alignment:
| Q |
18 |
atacttcctatctcgaggcacataaaagtaccactccttctctccgattgctgccaaagctgctcatcatcatcatatgcaattcatatatatcaaattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||| |
|
|
| T |
56312450 |
atacttcctatctcgaggcacataaaagtaccactccttctctccgattgctgccaaagctgctcatcatcatcat---ca--tcat-catatcaaattc |
56312357 |
T |
|
| Q |
118 |
aatcacataactaaatatataacagcttcat---atcatattttcgtatgtatgtgaagtgaattattaaattaaat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
56312356 |
aatcacataactaaatatataacagcttcatatcatcatatttgcgtatgtatgtgaagtgaattattaaattaaat |
56312280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 309 - 375
Target Start/End: Complemental strand, 56312189 - 56312123
Alignment:
| Q |
309 |
taaatcaaagagggatggcaacnnnnnnnngggtttccagaattgctttaggaaaggggaagttctc |
375 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312189 |
taaatcaaagagggatggcaacaaaaaaaagggtttccagaattgctttaggaaaggggaagttctc |
56312123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 521 - 558
Target Start/End: Complemental strand, 8449761 - 8449724
Alignment:
| Q |
521 |
acaagttcttcttcagttggatggaaacgaaaccctgg |
558 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
8449761 |
acaagttcttcatcagttgggtggaaacgaaaccctgg |
8449724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University