View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1516_low_52 (Length: 241)
Name: NF1516_low_52
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1516_low_52 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 33124167 - 33124376
Alignment:
| Q |
18 |
cactaaccataccagctattattccacagaagcagtaaagacagatcttatgaaacttccaagtgatttcctttccccttgatgcaattactctagttcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33124167 |
cactaaccataccagctattattccacagaagcagtaaagacagatcttatgaaacttccaagtgatttcctttccccttgatgcaattactctagttcc |
33124266 |
T |
|
| Q |
118 |
tttgcataagcatatggcttcaaaaagtgtaacagaaattgcaataggcaccttaaattgataaatagcacaccaaatttcagttagaccttgcagagaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33124267 |
tttgcataagcatatggcttcaaaaagtgtaacagaaattgcaataggcaccttaaattgataaatagcacaccaaatttcagttagaccttgcagagaa |
33124366 |
T |
|
| Q |
218 |
atagtattat |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
33124367 |
atagtattat |
33124376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 85 - 170
Target Start/End: Complemental strand, 7570782 - 7570697
Alignment:
| Q |
85 |
ttcctttccccttgatgcaattactctagttcctttgcataagcatatggcttcaaaaagtgtaacagaaattgcaataggcacct |
170 |
Q |
| |
|
|||||||||| ||||| ||| ||||| ||||||||| ||| ||||| ||||||||||| |||||||| || |||||||| |||| |
|
|
| T |
7570782 |
ttcctttccctttgatttaatcactcttgttcctttgtatatgcatacagcttcaaaaagcgtaacagagatagcaataggaacct |
7570697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University