View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1516_low_53 (Length: 240)
Name: NF1516_low_53
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1516_low_53 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 4 - 240
Target Start/End: Complemental strand, 24564414 - 24564177
Alignment:
| Q |
4 |
aatattctattcatatagtactagatattatttatttaataatcattgtatatagatttttatttctagtgttgaaaattgtttgaatgagtcagagtac |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24564414 |
aatattctattcatatagtactagatattatttatttaataatcattgcatatagatttttatttctagtgttgaaaattgtttgaatgagtcagagtac |
24564315 |
T |
 |
| Q |
104 |
taaaatacttatagtagcttcttctctttgtctctcttggataaactaagtttcaaacttcattttaaaccattgctagcccttggtaaaaatgttctat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24564314 |
taaaatacttatagtagcttcttctctttgtctctcttggataaactaagcttcaaacttcattttaaaccattgctagcccttggtaaaaatgttctat |
24564215 |
T |
 |
| Q |
204 |
ttccc-ttgtttttgttctttattgtactcacttatac |
240 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
24564214 |
ttccctttttttttgttctttattgtactcacttatac |
24564177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 83 - 124
Target Start/End: Complemental strand, 23598620 - 23598579
Alignment:
| Q |
83 |
tgtttgaatgagtcagagtactaaaatacttatagtagcttc |
124 |
Q |
| |
|
|||||||| |||||||||||| |||||||||| ||||||||| |
|
|
| T |
23598620 |
tgtttgaacgagtcagagtacaaaaatacttacagtagcttc |
23598579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University