View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1516_low_58 (Length: 230)
Name: NF1516_low_58
Description: NF1516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1516_low_58 |
 | |
|
| [»] scaffold0119 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0119 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 13420 - 13207
Alignment:
| Q |
1 |
cccttattatgctgcttttgcttcggccatcgcttttgcggtcggcgcctttgtgccgctactcggcgcggcgtttgtgaaagattataaggtgaggttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13420 |
cccttattatgctgcttttgcttcggccatcgcttttgcggtcggcgcctttgtgccgctactcggcgcggcgtttgtgaaagattataaggtgaggttg |
13321 |
T |
|
| Q |
101 |
ggagtagtggttggtgttgttagccttgctttgtttggctttggattgttgagtgctgttcttgggaaagcacccttggtgaagtcttctttgagggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13320 |
ggagtagtggttggtgttgttagccttgctttgtttggctttggattgttgagtgctgttcttgggaaagcacccttggtgaagtcttctttgagggttt |
13221 |
T |
|
| Q |
201 |
tgattggtggatgg |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13220 |
tgattggtggatgg |
13207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 19100 - 18887
Alignment:
| Q |
1 |
cccttattatgctgcttttgcttcggccatcgcttttgcggtcggcgcctttgtgccgctactcggcgcggcgtttgtgaaagattataaggtgaggttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19100 |
cccttattatgctgcttttgcttcggccatcgcttttgcggtcggcgcctttgtgccgctactcggcgcggcgtttgtgaaagattataaggtgaggttg |
19001 |
T |
|
| Q |
101 |
ggagtagtggttggtgttgttagccttgctttgtttggctttggattgttgagtgctgttcttgggaaagcacccttggtgaagtcttctttgagggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19000 |
ggagtagtggttggtgttgttagccttgctttgtttggctttggattgttgagtgctgttcttgggaaagcacccttggtgaagtcttctttgagggttt |
18901 |
T |
|
| Q |
201 |
tgattggtggatgg |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
18900 |
tgattggtggatgg |
18887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 1293174 - 1293387
Alignment:
| Q |
1 |
cccttattatgctgcttttgcttcggccatcgcttttgcggtcggcgcctttgtgccgctactcggcgcggcgtttgtgaaagattataaggtgaggttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1293174 |
cccttattatgctgcttttgcttcggccatcgcttttgcggtcggcgcctttgtgccgctactcggcgcggcgtttgtgaaagattataaggtgaggttg |
1293273 |
T |
|
| Q |
101 |
ggagtagtggttggtgttgttagccttgctttgtttggctttggattgttgagtgctgttcttgggaaagcacccttggtgaagtcttctttgagggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1293274 |
ggagtagtggttggtgttgttagccttgctttgtttggctttggattgttgagtgctgttcttgggaaagcacccttggtgaagtcttctttgagggttt |
1293373 |
T |
|
| Q |
201 |
tgattggtggatgg |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1293374 |
tgattggtggatgg |
1293387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University