View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15170_low_3 (Length: 236)
Name: NF15170_low_3
Description: NF15170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15170_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 1729527 - 1729316
Alignment:
| Q |
1 |
tagctaaagttagtactttgttgttgatagtaactcttattgctcaaattgaatcagcaaagtagttttacactcatcataatccactttcaannnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1729527 |
tagctaaagttagtactttgttgttgatagtaactcttattgctcaaattgaaccaacaaagtagttttacactcatcataatccactttcaattttttt |
1729428 |
T |
 |
| Q |
101 |
ctctattgtcacaattcactcgatatttatcacaaaagaagcatttatcctaagaaattggtatcattgagcaatggttcgattcaagatatcaactatg |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1729427 |
ctctattctcacaattcactcgatatttatcacaaaagaagcatttatcctaagaaattg-------tgagcaatggttcgattcaagatatcaactatg |
1729335 |
T |
 |
| Q |
201 |
gcgaatggaagcacaaatt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1729334 |
gcgaatggaagcacaaatt |
1729316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University