View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15171_low_4 (Length: 270)
Name: NF15171_low_4
Description: NF15171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15171_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 38892443 - 38892684
Alignment:
| Q |
11 |
gacatcatctcttcgctaaaaaccttaaaacatta-tgtatatatgtcacatctcatatatattcaacgttttgtctattcataattgatgtagaactaa |
109 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38892443 |
gacatcatatcttcgctcaaaaccttaaaacattaatgtgtatatgtcacatctcatatatattcaacgttttgtctattcataattgatgtagaattaa |
38892542 |
T |
|
| Q |
110 |
tcactcaaacttaaatccaacaatttgaaatctcacttttcacttgtcactcttctctgttctacatttgcattgctagtttaacattacacgtgtgtgt |
209 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38892543 |
tcactcaaacttaatcccaacaatttgaaatctcacttttcacttgtctctcttctctgttctacatttgcattgctagtttaacattacacgtgtgtgt |
38892642 |
T |
|
| Q |
210 |
ggataaatatattagcttataatggattagatttaacagtga |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38892643 |
ggataaatatattagcttataatggattagatttaacagtga |
38892684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University