View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15171_low_5 (Length: 237)
Name: NF15171_low_5
Description: NF15171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15171_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 49508621 - 49508842
Alignment:
| Q |
1 |
aaatacatcaaagattcctgcttaaaacaaggtgttacttgatagaattaatcagcaatgataattatttacttgaatgcatgcacattcagtttctctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49508621 |
aaatacatcaaagattcctgcttaaaacaaggtgttacttgatagaattaatcagcaatgataattatttacttgaatgcatgcacattcagtttctctc |
49508720 |
T |
 |
| Q |
101 |
cacatggttaggtggtgagaattggaggaaggtactcagatttggaacctagaatcttagccttagtatcaggaaaacattcaaatcctggaagagctgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49508721 |
cacatggttaggtggtgagaattggaggaaggtactcagatttggaacctagaatcttagccttagtatcaggaaaacattcaaatcctggaagagctgt |
49508820 |
T |
 |
| Q |
201 |
tatggttccattgttggttact |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49508821 |
tatggttccattgttggttact |
49508842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 177
Target Start/End: Original strand, 49520001 - 49520069
Alignment:
| Q |
109 |
taggtggtgagaattggaggaaggtactcagatttggaacctagaatcttagccttagtatcaggaaaa |
177 |
Q |
| |
|
|||||||| || || ||||||||||| |||||||| ||||| |||||| |||| | |||||||||||| |
|
|
| T |
49520001 |
taggtggtaagtatgggaggaaggtaatcagattttgaaccaagaatcaaagccattgtatcaggaaaa |
49520069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University