View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15171_low_6 (Length: 237)

Name: NF15171_low_6
Description: NF15171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15171_low_6
NF15171_low_6
[»] chr2 (1 HSPs)
chr2 (1-221)||(14902739-14902961)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 14902961 - 14902739
Alignment:
1 ataggcagatgcataattccaagcgatatacgtattagatcaaatactatgatttaataattgataaacaaaaaatatatattaatcgatggttacttag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
14902961 ataggcagatgcataattccaagcgatatacgtattagatcaaatactatgatttaataattaataaacaaaaaatatatattaatcgatggttacttag 14902862  T
101 gacaacaaaaagattatgagtgaaattaaaatacggaaagaaaacaaagtata-----tagagtagccaacagggtttacacagccaattctaacaacat 195  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||     ||||||||||||||||||||||||||||||||||   |||||    
14902861 gacaacaaaaagattatgagtgaaattaaaatacagaaagaaaacaaagtatatagattagagtagccaacagggtttacacagccaattct---aacat 14902765  T
196 ccagcaaatcaaaataatgaaacact 221  Q
    ||||||||||||||||||||||||||    
14902764 ccagcaaatcaaaataatgaaacact 14902739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University