View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15173_high_2 (Length: 367)
Name: NF15173_high_2
Description: NF15173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15173_high_2 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 11 - 367
Target Start/End: Complemental strand, 47126965 - 47126609
Alignment:
| Q |
11 |
aatgaagacaagaatcgatctcatacaatcttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126965 |
aatgaagacaagaatcgatctcatacaatcttgcaccattattatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgca |
47126866 |
T |
|
| Q |
111 |
ggttacctaccaaatcgtccaacggttagtcgtaggtttatgcctgagcaaggtacaccagagtatgaagagcttgagtcagatcctgaattagcattct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126865 |
ggttacctaccaaatcgtccaacggttagtcgtaggtttatgcctgagcaaggtacaccagagtatgaagagcttgagtcagatcctgaattagcattct |
47126766 |
T |
|
| Q |
211 |
taaaaacaatcacagctcagttccaaactcttcttggtgtgtcattgatagaagttctgtctaggcattcgactgaagaggtttatcttgggcagacagt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47126765 |
taaaaacaatcacagctcagttccaaactcttcttggtgtgtcattgatagaagttctgtctaggcattcgactgaagaggtttatcttggacagacagt |
47126666 |
T |
|
| Q |
311 |
agaccctgattggactgcagacgctgaaccattggcagcatttaggcgattttcaca |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126665 |
agaccctgattggactgcagacgctgaaccattggcagcatttaggcgattttcaca |
47126609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 46 - 115
Target Start/End: Original strand, 9606270 - 9606339
Alignment:
| Q |
46 |
ccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgcaggtta |
115 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| || ||||||||||| ||||||| |||||| |
|
|
| T |
9606270 |
ccattatcatatggactgcttctgctcttcatgcagctgttaattttggacaatatccttatggaggtta |
9606339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 54 - 133
Target Start/End: Complemental strand, 46709234 - 46709155
Alignment:
| Q |
54 |
atatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgcaggttacctaccaaatcgtccaac |
133 |
Q |
| |
|
|||||| | ||||| ||| | ||||||||||| |||||||||||||| |||| |||||||||| |||||| |||||||| |
|
|
| T |
46709234 |
atatggattgcttcagctctacatgcagctgtaaactttggacaatatccttttgcaggttactcaccaaaccgtccaac |
46709155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 108
Target Start/End: Complemental strand, 6456223 - 6456151
Alignment:
| Q |
36 |
caatcttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatg |
108 |
Q |
| |
|
||||||||| |||||||||||||| ||||| ||| |||||||||| || ||||||||||| || ||||||| |
|
|
| T |
6456223 |
caatcttgctccattatcatatggactgcttcagctcttcatgcagcagttaactttggacagtatccttatg |
6456151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 36 - 106
Target Start/End: Complemental strand, 6449756 - 6449686
Alignment:
| Q |
36 |
caatcttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaataccctta |
106 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||| ||||||||||||| || || |||||||| ||||| |
|
|
| T |
6449756 |
caatcttgctccattattatatggactgcttctgctcttcatgcagctgttaatttcggacaatatcctta |
6449686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 40 - 100
Target Start/End: Complemental strand, 7458044 - 7457984
Alignment:
| Q |
40 |
cttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaata |
100 |
Q |
| |
|
||||||||||| |||||||| | ||||| || ||||||||||||| || ||||||||||| |
|
|
| T |
7458044 |
cttgcaccattctcatatggattgcttcagcacttcatgcagctgttaattttggacaata |
7457984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 40 - 100
Target Start/End: Complemental strand, 7470446 - 7470386
Alignment:
| Q |
40 |
cttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaata |
100 |
Q |
| |
|
||||||||||| |||||||| | ||||| || ||||||||||||| || ||||||||||| |
|
|
| T |
7470446 |
cttgcaccattctcatatggattgcttcagcacttcatgcagctgttaattttggacaata |
7470386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University