View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15173_low_10 (Length: 262)
Name: NF15173_low_10
Description: NF15173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15173_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 253
Target Start/End: Original strand, 32468052 - 32468287
Alignment:
| Q |
19 |
ctgtttaacttcatttgattgtttagtgaatgtgacttagagaaagaagaagatgatgagtcacaaaggttatgaggtgaaaataatgagaatggagtat |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32468052 |
ctgtttaacttcatttgattgtttggtgaatgtgacttagagaaagaagaagatgatgagtcacaaaggttatgaggtgaaaataatgagaatggagtat |
32468151 |
T |
 |
| Q |
119 |
cattcaaggaagttgatggg-ttttttatgagcatagttgtgtagtgttgttttgagaaatgtgagttcacttcctatgaatttgtttatttgctatatt |
217 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
32468152 |
cattcaaggaagttgatgggtttttttatgagcatagttgtgtagtgttgttttgagaaatgtgagttcacttcctatggatttgtttatttgctctatt |
32468251 |
T |
 |
| Q |
218 |
atttccctttgtttttcagttctcttcttttcagtc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32468252 |
atttccctttgtttttcagttctcttcttttcagtc |
32468287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University