View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15173_low_7 (Length: 296)
Name: NF15173_low_7
Description: NF15173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15173_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 260
Target Start/End: Original strand, 29354523 - 29354762
Alignment:
| Q |
20 |
tgaggcaattcaacttggtgcttttcagaaacttttggttatgttgcaagttgggtgtgaggagaaaacaaaggagaatactactgagttgttgaaattg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29354523 |
tgaggcaattcaacttggtgcttttcagaaacttttggttatgttgcaagttgggtgtgaggagaaaacaaaggagaatactactgagttgttgaaattg |
29354622 |
T |
 |
| Q |
120 |
ttgaatggttatagaagcaaagctgaatgtgttgataattcattagatttcaagtatctcaagaactaagaagcctttctaaatactgattcaagannnn |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29354623 |
ttgaatggttatagaagcaaagctgaatgtgttgataattcattagatttcaagtatctcaagaactaagaagcctttctaaatactgattcaagagatt |
29354722 |
T |
 |
| Q |
220 |
nnnnnngatgaatactcatgagaatgagattcattcatttc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29354723 |
tttttt-atgaatactcatgagaatgagattcattcatttc |
29354762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 155
Target Start/End: Original strand, 33090064 - 33090199
Alignment:
| Q |
20 |
tgaggcaattcaacttggtgcttttcagaaacttttggttatgttgcaagttgggtgtgaggagaaaacaaaggagaatactactgagttgttgaaattg |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | ||| |||||||||| || |||| |||| || |||||||| ||||||| |||||||||||| |
|
|
| T |
33090064 |
tgaggcaattcaacttgggatgtttcagaaactacttgttttgttgcaagtaggttgtgctgagagtaccaaggagaaagctactgaattgttgaaattg |
33090163 |
T |
 |
| Q |
120 |
ttgaatggttatagaagcaaagctgaatgtgttgat |
155 |
Q |
| |
|
||||| ||||||| ||||||||| || ||||||||| |
|
|
| T |
33090164 |
ttgaacggttataaaagcaaagcagagtgtgttgat |
33090199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University