View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15174_low_3 (Length: 354)
Name: NF15174_low_3
Description: NF15174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15174_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 30 - 340
Target Start/End: Original strand, 52290006 - 52290316
Alignment:
| Q |
30 |
ttttcctctttgattccctgtaatactttgaaacctcactctctcaaccttctttacacgacttagcgtccttctatttgcgctagttaaatctctattc |
129 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52290006 |
ttttcctctttgattctctgtaatactttgaaacctcactctctcaaccttctttacacgacttagcgtccttctatttgcgctagttaaatctttattc |
52290105 |
T |
 |
| Q |
130 |
tcctttttatcactaaaatttgagatagccttaactttactgtccatagtactagacgaatggaccttctcgtcttccgagaatcttgctaagcaagaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52290106 |
tcctttttatcactaaaatttgagatagccttaactttactgtccatagtactagacgaatggaccttctcgtcttccgagaatcttgctaagcaagaaa |
52290205 |
T |
 |
| Q |
230 |
tcaacgattcactttcctcttcattgattttatcaattagaaactcacttcttcttgaaggaacgtcggatgtacttttccggcctttggatttcacttt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52290206 |
tcaacgattcactttcctcttcattgattttatcaattagaaactcacttcttcttgaaggaacgtcggatgtacttttccggcctttggatttcacttt |
52290305 |
T |
 |
| Q |
330 |
cttgacctttg |
340 |
Q |
| |
|
||||||||||| |
|
|
| T |
52290306 |
cttgacctttg |
52290316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University