View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15175_high_17 (Length: 344)
Name: NF15175_high_17
Description: NF15175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15175_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 269
Target Start/End: Original strand, 33647326 - 33647577
Alignment:
| Q |
18 |
gttggagcatagtttttgtcgaaaagttggtttatgaaacttatgctacggttacattttgctggtaaagatatgaatatactatcagaattcacttctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33647326 |
gttggagcatagtttttgtcgaaaagttggtttatgaaacttatgctacggttacattttgctggtaaagatatgaatatactatcagaattcacttctt |
33647425 |
T |
|
| Q |
118 |
gaacttttagttccccaatcttgagttctttattgatgctacagtttagtttgatttcacaaccttcggaaaatccaaatggatacttaacagattgttt |
217 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33647426 |
gaactttcagttcaccaatcttgagttctttattgatgctgcagtttagtttgattttacaaccttcggaaaatccaaatggatacttaacagattgttt |
33647525 |
T |
|
| Q |
218 |
tccacatctttgaacacagttagttttgttttgttcagcagttgttactgtt |
269 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33647526 |
tccacatctttgaacacagtcagttttgttttgttcagcagttgttactgtt |
33647577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University