View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15175_low_18 (Length: 378)
Name: NF15175_low_18
Description: NF15175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15175_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 23 - 360
Target Start/End: Original strand, 12344259 - 12344596
Alignment:
| Q |
23 |
gccacatcaacaacaccaaagcttaagccaagaacttggttttcttagacctattagaggaattcctgtttatcaaaaccctcctcctttgtcattccct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12344259 |
gccacatcaacaacaccaaagcttaagccaagaacttggttttcttagacctattagaggaattcctgtttatcaaaaccctcctcctttgtcattccct |
12344358 |
T |
 |
| Q |
123 |
caacttcataatcataatcataatctaaatcatcttcatattctagatggtactactactactacaccttcttcaatttctaacaccaacaacacaagtt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12344359 |
caacttcataatcataatcataatctaaatcatcttcatattttagatggtactactactactacaccttcttctatttctaacaccaacaacacaagtt |
12344458 |
T |
 |
| Q |
223 |
caagcccttttcaatctcaagctttgatgaggtcaagattcttgtcaagattcccagcaaaaagaagcatgagagctccaaggatgcgttggactactac |
322 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12344459 |
caagcccttttcaatcacaagctttgatgaggtcaagattcttgtcaagattcccagcaaaaagaagcatgagagctccaaggatgcgttggactactac |
12344558 |
T |
 |
| Q |
323 |
acttcatgctcgatttgttcatgctgttgaactcttag |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12344559 |
acttcatgctcgatttgttcatgctgttgaactcttag |
12344596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 352
Target Start/End: Original strand, 29258748 - 29258820
Alignment:
| Q |
280 |
caaaaagaagcatgagagctccaaggatgcgttggactactacacttcatgctcgatttgttcatgctgttga |
352 |
Q |
| |
|
||||||||||||||||||| ||||| ||||| ||||| | ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
29258748 |
caaaaagaagcatgagagcaccaagaatgcgatggacaagtactcttcatgctagatttgttcatgctgttga |
29258820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 294 - 360
Target Start/End: Complemental strand, 27568805 - 27568739
Alignment:
| Q |
294 |
agagctccaaggatgcgttggactactacacttcatgctcgatttgttcatgctgttgaactcttag |
360 |
Q |
| |
|
|||||||| ||||||||||||||||| || |||||| ||| |||||||||||||||||||| |||| |
|
|
| T |
27568805 |
agagctccgaggatgcgttggactaccactcttcataatcgctttgttcatgctgttgaacttttag |
27568739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University