View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15175_low_20 (Length: 323)
Name: NF15175_low_20
Description: NF15175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15175_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 11 - 305
Target Start/End: Complemental strand, 46944155 - 46943861
Alignment:
| Q |
11 |
agagaattttacttgatttcaaaatcaatgatacagaacctcatccacacttcccataaagctgtttgttactttctttcttttatcttgttttctcttt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46944155 |
agagaattttacttgatttcaaaatcaatgatatagaacctcatccacacttcccataaagctgtttgttactttctttcttttatcttgttttctcttt |
46944056 |
T |
 |
| Q |
111 |
gtggggtctaaataaggcagccttctctaacaacatgcctgcttccttccactttgtatcacacaatatgcttcnnnnnnnctttcattctttttcattg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46944055 |
gtggggtctaaataaggcagccttctctaacaacatgcctgcttccttccactttgtatcacacaatatgcttctttttttctttcattctttttcattg |
46943956 |
T |
 |
| Q |
211 |
aaatcatacacatcagtgaatttaattagatatctctgttcttttgcagtcaaagttattctatctttaagctgaacaatgttgcaagttatgcc |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46943955 |
aaatcatacacatcagtgaatttaattagatatctctgttcttttgcagtcaaagttattctatctttaagctgaacaatgttgcaagttatgcc |
46943861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University