View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15175_low_35 (Length: 258)
Name: NF15175_low_35
Description: NF15175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15175_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 8 - 239
Target Start/End: Complemental strand, 43331235 - 43331005
Alignment:
| Q |
8 |
gagcagagaaacatttccaaggtaagatttttgcccacctttgttattaannnnnnnnnnnnnnatgggtagattgttattcttaattttgttttagcta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43331235 |
gagcagagaaacatttccaaggtaagatttttgcccacctttgttattaatttttttttt----atgggtagattgttattcttaattttgttttagcta |
43331140 |
T |
 |
| Q |
108 |
ctattttaaaaattaaactactccatgatgctaatataattgttcatgcnnnnnnnttgtatagctaaat---atgatggattgatgccatatatatgct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43331139 |
ctattttaaaaattaaactactccatgatgctaaaataattgttcatgcaaaaaaattgtatagctaaatatgatgatggattgatgccatatatatgct |
43331040 |
T |
 |
| Q |
205 |
gatctttaccaaggcaacaccatacaattttaagt |
239 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43331039 |
gatctttaccaaggcaacaccatgcaattttaagt |
43331005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 195 - 237
Target Start/End: Complemental strand, 43321743 - 43321701
Alignment:
| Q |
195 |
tatatatgctgatctttaccaaggcaacaccatacaattttaa |
237 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||| |||||||| |
|
|
| T |
43321743 |
tatatatgataatctttaccaaggcaacaccataaaattttaa |
43321701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University