View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15175_low_37 (Length: 251)
Name: NF15175_low_37
Description: NF15175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15175_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 4 - 244
Target Start/End: Complemental strand, 21101942 - 21101697
Alignment:
| Q |
4 |
aattacttcaagaagagttggaaacaaccaagaaggaaaaccttgagttgaaatttgagttgggcatccaaaatgaaagagnnnnnnnnn-----tttaa |
98 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
21101942 |
aattacttcaagaagagttggaaaccaccaagaaggaaaaccttgagttgaaatttgagttgggcatccaaaatgaaaaaaaaaaaaaaaacgaatttaa |
21101843 |
T |
|
| Q |
99 |
tcaataggtcgaactcaataaatgtctttaatctttgtgtttagtgggtttttatatttatttttataatgtcattaagttgtttatgttagtcttccaa |
198 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21101842 |
tcaataggtcaaactcaataaatgtctttaatctttgtgtttagtgggtttttatatttatttttataatgtcattaagttgtttatgttagtcttccaa |
21101743 |
T |
|
| Q |
199 |
tgttaatcttaatgttgttaattattggatgtaaagtcctatgcta |
244 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21101742 |
tgttagtcttaatgttgttaattattggatgtaaagtcctatgcta |
21101697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University