View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15175_low_52 (Length: 201)
Name: NF15175_low_52
Description: NF15175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15175_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 2e-75; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 19 - 173
Target Start/End: Original strand, 48900318 - 48900472
Alignment:
| Q |
19 |
agaagggaattggaactgtgttcatattgatttgaaaattttgtcaataggaaatctagctattgcattcagttgattgtaatgtatactgaagcagatg |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48900318 |
agaagggaattggaattgtgttcatattgatttgaaaattttgtcaataggaaatctagctattggattcagttgattgtaatgtatactgaagcagatg |
48900417 |
T |
|
| Q |
119 |
caaatccctagtggacggaatgtgaagctgtggatgattatctgtgatcagatat |
173 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48900418 |
caaatccctagtggacgaaatgtgaagctgtggatgattatctgtgatcagatat |
48900472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 19 - 125
Target Start/End: Original strand, 48866066 - 48866172
Alignment:
| Q |
19 |
agaagggaattggaactgtgttcatattgatttgaaaattttgtcaataggaaatctagctattgcattcagttgattgtaatgtatactgaagcagatg |
118 |
Q |
| |
|
|||||||||||||||| | |||||| |||||||| |||||||| ||||||||||||||||||||| |||||||| ||| ||||||||| ||||| ||||| |
|
|
| T |
48866066 |
agaagggaattggaacagagttcattttgatttgtaaattttgacaataggaaatctagctattggattcagtttattttaatgtatattgaagtagatg |
48866165 |
T |
|
| Q |
119 |
caaatcc |
125 |
Q |
| |
|
| ||||| |
|
|
| T |
48866166 |
ccaatcc |
48866172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 38 - 127
Target Start/End: Original strand, 48856595 - 48856683
Alignment:
| Q |
38 |
gttcatattgatttgaaaattttgtcaataggaaatctagctattgcattcagttgattgtaatgtatactgaagcagatgcaaatccct |
127 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| |||||||||||||| ||| |||||||| || | |||| ||||||||||| ||||||| |
|
|
| T |
48856595 |
gttcattttgatttgaaaattttgcaaatagtaaatctagctattggattgagttgatt-tagtttatattgaagcagatggcaatccct |
48856683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 59 - 119
Target Start/End: Complemental strand, 35647774 - 35647714
Alignment:
| Q |
59 |
ttgtcaataggaaatctagctattgcattcagttgattgtaatgtatactgaagcagatgc |
119 |
Q |
| |
|
||||||||| ||||||||||||||| ||| ||||||||||||||| || ||||||||||| |
|
|
| T |
35647774 |
ttgtcaataagaaatctagctattggatttagttgattgtaatgtttatcgaagcagatgc |
35647714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University