View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15176_low_29 (Length: 243)
Name: NF15176_low_29
Description: NF15176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15176_low_29 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 12147093 - 12146855
Alignment:
| Q |
1 |
attctacactccacgataattcttatactgctcaaataacttaaaactttggaagaagaaagatattgaaaattttagaaatcacactttttagcaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
12147093 |
attctacactccacgataattcttatactgctcaaataacttaaaactttggaagaagaaagatat-gaaaattttagaaatcacactttttagcaaaat |
12146995 |
T |
 |
| Q |
101 |
gttttctcttccgcctagggggatcgtcataaccgtaaaaatatttatcttaaaacaaccctaaaattgtaacnnnnnnnnnnnnnngaaatgaatgaac |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
12146994 |
gttttctcttctgcctagggggatcgtcacaaccgtcaaaatatttgtcttaaaacaaccctaaaattgtaccaataaaataaaaaagaaatgaatgaac |
12146895 |
T |
 |
| Q |
201 |
tctttcaaagtcaaattgatagataatactatatattatgact |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12146894 |
tctttcaaagtcaaattgatagataa---tatatattatgact |
12146855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University