View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15176_low_9 (Length: 412)
Name: NF15176_low_9
Description: NF15176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15176_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 52 - 342
Target Start/End: Original strand, 45362797 - 45363087
Alignment:
| Q |
52 |
gtcagtggagggtgaggatgagcacaagagaggggaggaaggtggagcaaaaacgatgccaccagcaagtataatgacgaggctgatattgataatggtt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362797 |
gtcagtggagggtgaggatgagcacaagagaggggaggaaggtggggcaaaaacgatgccaccagcaagtataatgacgaggctgatattgataatggtt |
45362896 |
T |
 |
| Q |
152 |
tggagaaaacttatcagaaacccaaacacatattcgagcattatcggcctaacttggtcactcatttcattcaggtggaatattgaaatgcctgttatca |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362897 |
tggagaaaacttatcagaaacccaaacacatattcgagcattatcggcctaacttggtcactcatttcattcaggtggaatattgaaatgcctgttatca |
45362996 |
T |
 |
| Q |
252 |
tagaaaagtctatttccatattgtcagatgcagggcttggcatggccatgtacagtcttggttagtattcaatcaaactcaatggtgttta |
342 |
Q |
| |
|
||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45362997 |
tagcaaagtctatttccatattgtcggatgcagggcttggcatggccatgttcagtcttggttagtattcaataaaactcaatggtgttta |
45363087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 107 - 227
Target Start/End: Original strand, 25040218 - 25040338
Alignment:
| Q |
107 |
atgccaccagcaagtataatgacgaggctgatattgataatggtttggagaaaacttatcagaaacccaaacacatattcgagcattatcggcctaactt |
206 |
Q |
| |
|
||||||||||| ||| | ||||| ||||| |||||||| |||||||||||||||||||||||||| |||||||| ||||| ||| | || || || |||| |
|
|
| T |
25040218 |
atgccaccagctagtgtgatgacaaggcttatattgattatggtttggagaaaacttatcagaaatccaaacacttattctagcttaattggtctcactt |
25040317 |
T |
 |
| Q |
207 |
ggtcactcatttcattcaggt |
227 |
Q |
| |
|
|||| | |||||||||||| |
|
|
| T |
25040318 |
ggtctttggtttcattcaggt |
25040338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 231 - 313
Target Start/End: Original strand, 25040700 - 25040782
Alignment:
| Q |
231 |
atattgaaatgcctgttatcatagaaaagtctatttccatattgtcagatgcagggcttggcatggccatgtacagtcttggt |
313 |
Q |
| |
|
||||||||||||||| || |||| ||||||||||||||| ||||||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
25040700 |
atattgaaatgcctgccattatagcaaagtctatttccattctgtcagatgcaggacttggcatggctatgttcagtcttggt |
25040782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University