View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15178_high_27 (Length: 358)
Name: NF15178_high_27
Description: NF15178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15178_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 26277836 - 26277498
Alignment:
| Q |
1 |
aatgtgggggatccgtccaccattgtgagtgtaaactatgaccatgcttaacttactcattggccagagttacactccctatggatgtgtgtgaaacgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26277836 |
aatgtgggggatccgtccaccattgtgagtgtaaactatgaccatgcttaacttactcattggccagagttacactccctatggatgtgtgtggaacgac |
26277737 |
T |
 |
| Q |
101 |
aagaaaaagtctcggtaag-ctatacaattgcgccatctaactctcaaagtccaaggaactgcaatgtgttgagagaaagctttcaccaccataagtgag |
199 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26277736 |
aagaaaaagtctcggtaaggctatacaattgcgccatctaactctcaaagtccaaggaactgcaatgtgttgagagaaagctttcaccaccataagtgag |
26277637 |
T |
 |
| Q |
200 |
tccgtttcaatccatatgtccgaccaattcagctccacagctttctcaattgcaaacatagcggtgcacagctcagctacaaacgcagaggaatgcccaa |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26277636 |
tccgtttcaatccatatgtccgaccaattcagctccacagctttctcaattgcaaacatagcggtgcacagctcagctacaaacgcagaggaatgcccaa |
26277537 |
T |
 |
| Q |
300 |
tattcaggacaaaacctgccaaaaaagttccctcccagt |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26277536 |
tattcaggacaaaacctgccaaaaaagttccctcccagt |
26277498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University