View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15178_high_32 (Length: 321)
Name: NF15178_high_32
Description: NF15178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15178_high_32 |
 |  |
|
| [»] scaffold0160 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0160 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 126 - 197
Target Start/End: Complemental strand, 20818 - 20747
Alignment:
| Q |
126 |
cgggcaagtctggcatgttacatgtttcttctctcacttcctgcatgtccatcttcaattaaatatcaataa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20818 |
cgggcaagtctggcatgttacatgtttcttctctcacttcctgcatgtccatcttcaattaaatatcaataa |
20747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 271 - 321
Target Start/End: Complemental strand, 20674 - 20624
Alignment:
| Q |
271 |
cttagtgaagaggaatgcttgtcacctactccttttatagtttctactctc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20674 |
cttagtgaagaggaatgcttgtcacctactccttttatagtttctactctc |
20624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University